Stem-loop sequence bmo-mir-2851-2

AccessionMI0012990 (change log)
DescriptionBombyx mori miR-2851-2 stem-loop
Gene family MIPF0001014; mir-2851
Stem-loop
   --ugugguga        uc   a         a c    -     aaug 
5'           ucucucua  aca ucaucaugc c cagu gauau    u
             ||||||||  ||| ||||||||| | |||| |||||     
3'           agagagau  ugu aguagugug g guca cuaua    u
   gagaagauaa        ua   c         a a    a     caca 
Get sequence
Deep sequencing
55 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581684.1: 346562-346660 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2851-2
bmo-mir-2733e-2NW_004581684.1: 342566-342664 [-]
bmo-mir-2733e-1NW_004581684.1: 342896-342993 [-]
bmo-mir-2733iNW_004581684.1: 344891-344998 [-]
bmo-mir-2733fNW_004581684.1: 346080-346197 [-]
bmo-mir-2733a-2NW_004581684.1: 346489-346605 [-]
bmo-mir-2851-2NW_004581684.1: 346562-346660 [+]
bmo-mir-2733a-3NW_004581684.1: 346598-346745 [-]
bmo-mir-2733b-1NW_004581684.1: 346939-347018 [-]
bmo-mir-2733hNW_004581684.1: 347062-347142 [-]
bmo-mir-2733b-2NW_004581684.1: 347220-347348 [-]
bmo-mir-2851-1NW_004581684.1: 347670-347768 [+]
bmo-mir-2733a-1NW_004581684.1: 347677-347760 [-]
bmo-mir-2733gNW_004581684.1: 347847-347958 [-]
bmo-mir-2733cNW_004581684.1: 353724-353805 [-]
bmo-mir-9dNW_004581684.1: 354559-354643 [-]
Database links

Mature sequence bmo-miR-2851

Accession MIMAT0013783
Sequence

68 - 

ugugaugacuguauuagagaga

 - 89

Get sequence
Deep sequencing100 reads, 3 experiments
Evidence not experimental
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).