Stem-loop sequence bmo-mir-306b

AccessionMI0012989 (change log)
Previous IDsbmo-mir-306-as
DescriptionBombyx mori miR-306b stem-loop
Gene family MIPF0000313; mir-306
Literature search

2 open access papers mention bmo-mir-306b
(19 sentences)

Stem-loop
   - a  --    g  g   c  g   c         accg 
5'  g gc  ccgc cu agg ac agg ggcucugag    g
    | ||  |||| || ||| || ||| |||||||||     
3'  c cg  ggcg ga ucc ug ucc cugagacuc    c
   g c  cc    -  g   a  a   a         acca 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581774.1: 30994-31069 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-306b
bmo-mir-9bNW_004581774.1: 31448-31537 [-]
bmo-mir-79NW_004581774.1: 31444-31543 [+]
bmo-mir-306bNW_004581774.1: 30994-31069 [-]
bmo-mir-306aNW_004581774.1: 30978-31085 [+]
bmo-mir-9cNW_004581774.1: 28981-29088 [+]
Database links

Mature sequence bmo-miR-306b

Accession MIMAT0013782
Previous IDsbmo-miR-306-as
Sequence

11 - 

ugaggcacgaggcggcucuga

 - 31

Get sequence
Deep sequencing27 reads, 3 experiments
Evidence not experimental
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).