Stem-loop sequence eca-mir-92a-2

AccessionMI0012987 (change log)
DescriptionEquus caballus miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention eca-mir-92a-2
(2 sentences)

Stem-loop
     a    ug   g     uu  u   u     -      
5' uc uccg  ggu gggau  gu gca uacuu guguu 
   || ||||  ||| |||||  || ||| ||||| |||| a
3' ag aggu  ccg cccug  ca cgu augaa uauau 
     a    gu   g     uu  -   u     a      
Get sequence
Deep sequencing
346310 reads, 2.56e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106692042-106692116 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-92a-2
eca-mir-106achrX: 106692701-106692781 [-]
eca-mir-18bchrX: 106692551-106692609 [-]
eca-mir-20bchrX: 106692311-106692379 [-]
eca-mir-19b-2chrX: 106692173-106692268 [-]
eca-mir-92a-2chrX: 106692042-106692116 [-]
eca-mir-363chrX: 106691883-106691957 [-]
Database links

Mature sequence eca-miR-92a

Accession MIMAT0013089
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Deep sequencing378363 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).