Stem-loop sequence eca-mir-532

AccessionMI0012979 (change log)
DescriptionEquus caballus miR-532 stem-loop
Gene family MIPF0000113; mir-188
Literature search

2 open access papers mention eca-mir-532
(3 sentences)

Stem-loop
   gauuu    u       a  u      a    a   cc  uggca 
5'      gcuu cucucuu ca gccuug gugu gga  gu     u
        |||| ||||||| || |||||| |||| |||  ||     c
3'      cgaa gggagga gu cggaac caca ccu  ca     u
   ---uc    c       c  u      c    c   cc  uuaau 
Get sequence
Deep sequencing
5022 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 40068460-40068549 [+]
sense
ENSECAT00000011707 ; CLCN5-201; intron 1
Clustered miRNAs
< 10kb from eca-mir-532
eca-mir-532chrX: 40068460-40068549 [+]
eca-mir-188chrX: 40068847-40068914 [+]
eca-mir-500-1chrX: 40073284-40073367 [+]
eca-mir-362chrX: 40073827-40073892 [+]
eca-mir-501chrX: 40074566-40074649 [+]
eca-mir-500-2chrX: 40075101-40075184 [+]
eca-mir-660chrX: 40076530-40076626 [+]
eca-mir-502chrX: 40077407-40077486 [+]
Database links

Mature sequence eca-miR-532-5p

Accession MIMAT0013235
Sequence

19 - 

caugccuugaguguaggaccgu

 - 40

Get sequence
Deep sequencing4955 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-532-3p

Accession MIMAT0013236
Sequence

56 - 

ccucccacacccaaggcuugca

 - 77

Get sequence
Deep sequencing67 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).