Stem-loop sequence eca-mir-509a

AccessionMI0012977 (change log)
Previous IDseca-mir-509
DescriptionEquus caballus miR-509 stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention eca-mir-509a
(1 sentences)

Stem-loop
   ----   ac   -     g   cc    -     ca   g       --g  u 
5'     cau  ugu gugug uac  uacu gcaga  gug caaucau   ua a
       |||  ||| ||||| |||  |||| |||||  ||| |||||||   ||  
3'     gua  aca uacac aug  guga cgucu  cac guuagua   au a
   uaga   -c   g     a   au    a     -c   a       aaa  u 
Get sequence
Deep sequencing
5026 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 116788793-116788890 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-509a
eca-mir-8908nchrX: 116796896-116797040 [-]
eca-mir-514chrX: 116793914-116794002 [-]
eca-mir-509achrX: 116788793-116788890 [-]
eca-mir-509bchrX: 116783204-116783336 [-]
Database links

Mature sequence eca-miR-509a-5p

Accession MIMAT0013233
Previous IDseca-miR-509-5p
Sequence

20 - 

uacugcagacaguggcaauca

 - 40

Get sequence
Deep sequencing2148 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).