Stem-loop sequence eca-mir-508

AccessionMI0012976 (change log)
DescriptionEquus caballus miR-508 stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention eca-mir-508
(1 sentences)

Stem-loop
   ---     -----  -  agc   -     g   c               u  u   cauaga 
5'    accac     uc uc   ugg gugua ugc cuacuccagagggug ca uca      c
      |||||     || ||   ||| ||||| ||| ||||||||||||||| || |||       
3'    uggug     ag ag   acu cacau aug gaugagguuuuccac gu agu      u
   cgg     uauau  c  -gu   a     a   a               u  u   acgaaa 
Get sequence
Deep sequencing
2601 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 116765762-116765878 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-508
eca-mir-507bchrX: 116771992-116772128 [-]
eca-mir-508chrX: 116765762-116765878 [-]
eca-mir-507achrX: 116755935-116756029 [-]
Database links

Mature sequence eca-miR-508-5p

Accession MIMAT0013231
Sequence

27 - 

uacuccagagggugucauucaca

 - 49

Get sequence
Deep sequencing34 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-508-3p

Accession MIMAT0013232
Sequence

62 - 

ugauugucaccuuuuggaguaga

 - 84

Get sequence
Deep sequencing2561 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).