Stem-loop sequence eca-mir-507a

AccessionMI0012975 (change log)
Previous IDseca-mir-507
DescriptionEquus caballus miR-507 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   caug    -     g    c    uc    a      uc     ggc 
5'     uugu gugca ugcu cacu  agga gugcca  caugu   u
       |||| ||||| |||| ||||  |||| ||||||  |||||    
3'     gaca cacgu auga guga  uucu cacggu  guaua   a
   caug    a     a    a    ga    c      ua     aag 
Get sequence
Deep sequencing
359 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 116755935-116756029 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-507a
eca-mir-508chrX: 116765762-116765878 [-]
eca-mir-507achrX: 116755935-116756029 [-]
eca-mir-506achrX: 116755599-116755743 [-]
eca-mir-514achrX: 116750733-116750827 [-]
Database links

Mature sequence eca-miR-507a

Accession MIMAT0013230
Previous IDseca-miR-507
Sequence

57 - 

auuggcaccucuuagagugaa

 - 77

Get sequence
Deep sequencing354 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).