Stem-loop sequence eca-mir-503

AccessionMI0012972 (change log)
DescriptionEquus caballus miR-503 stem-loop
Gene family MIPF0000183; mir-503
Stem-loop
   u    ua                 g   u g  g 
5'  gccc  gcagcgggaacaguacu cag g gc a
    ||||  ||||||||||||||||| ||| | || u
3'  cggg  cgucguccuuguuauga guc c ug c
   a    cc                 g   u g  g 
Get sequence
Deep sequencing
377 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106954617-106954687 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-503
eca-mir-424chrX: 106954949-106955046 [-]
eca-mir-503chrX: 106954617-106954687 [-]
eca-mir-542chrX: 106949741-106949826 [-]
eca-mir-450cchrX: 106948953-106949041 [-]
eca-mir-450achrX: 106948818-106948908 [-]
eca-mir-450bchrX: 106948655-106948733 [-]
Database links

Mature sequence eca-miR-503

Accession MIMAT0013227
Sequence

6 - 

uagcagcgggaacaguacugcag

 - 28

Get sequence
Deep sequencing126 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).