Stem-loop sequence eca-mir-502

AccessionMI0012971 (change log)
DescriptionEquus caballus miR-502 stem-loop
Gene family MIPF0000139; mir-500
Literature search

1 open access papers mention eca-mir-502
(1 sentences)

Stem-loop
   ugcucc        -         uau ug     uag   ugu 
5'       cccucucu aauccuugc   c  ggugc   ugc   c
         |||||||| |||||||||   |  |||||   |||   u
3'       gggagaga uuaggaacg   g  ccacg   acg   c
   ------        c         --- gu     -ua   uaa 
Get sequence
Deep sequencing
713 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 40077407-40077486 [+]
sense
ENSECAT00000011707 ; CLCN5-201; intron 1
Clustered miRNAs
< 10kb from eca-mir-502
eca-mir-532chrX: 40068460-40068549 [+]
eca-mir-188chrX: 40068847-40068914 [+]
eca-mir-500-1chrX: 40073284-40073367 [+]
eca-mir-362chrX: 40073827-40073892 [+]
eca-mir-501chrX: 40074566-40074649 [+]
eca-mir-500-2chrX: 40075101-40075184 [+]
eca-mir-660chrX: 40076530-40076626 [+]
eca-mir-502chrX: 40077407-40077486 [+]
Database links

Mature sequence eca-miR-502-5p

Accession MIMAT0013225
Sequence

16 - 

auccuugcuaucugggugcua

 - 36

Get sequence
Deep sequencing47 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-502-3p

Accession MIMAT0013226
Sequence

52 - 

aaugcaccugggcaaggauuca

 - 73

Get sequence
Deep sequencing666 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).