Stem-loop sequence eca-mir-500-2

AccessionMI0012969 (change log)
DescriptionEquus caballus miR-500-2 stem-loop
Gene family MIPF0000139; mir-500
Literature search

1 open access papers mention eca-mir-500-2
(1 sentences)

Stem-loop
       c       -u         uac ug    agag   uuu 
5' gcuc cccucuc  aauccuugc   c  ggug    ugc   c
   |||| |||||||  |||||||||   |  ||||    |||   u
3' ugag gggagag  uuaggaacg   g  ccac    acg   g
       a       cc         --- gu    -gua   uaa 
Get sequence
Deep sequencing
785 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 40075101-40075184 [+]
sense
ENSECAT00000011707 ; CLCN5-201; intron 1
Clustered miRNAs
< 10kb from eca-mir-500-2
eca-mir-532chrX: 40068460-40068549 [+]
eca-mir-188chrX: 40068847-40068914 [+]
eca-mir-500-1chrX: 40073284-40073367 [+]
eca-mir-362chrX: 40073827-40073892 [+]
eca-mir-501chrX: 40074566-40074649 [+]
eca-mir-500-2chrX: 40075101-40075184 [+]
eca-mir-660chrX: 40076530-40076626 [+]
eca-mir-502chrX: 40077407-40077486 [+]
Database links

Mature sequence eca-miR-500

Accession MIMAT0013223
Sequence

13 - 

uaauccuugcuaccugggugaga

 - 35

Get sequence
Deep sequencing170 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).