Stem-loop sequence eca-mir-500-1

AccessionMI0012968 (change log)
Previous IDseca-mir-500
DescriptionEquus caballus miR-500 stem-loop
Gene family MIPF0000139; mir-500
Literature search

1 open access papers mention eca-mir-500-1
(1 sentences)

Stem-loop
       c c     -u         uac ug    -aga     g 
5' gcuc c cucuc  aauccuugc   c  ggug    guguu u
   |||| | |||||  |||||||||   |  ||||    ||||| c
3' cgag g gagag  uuaggaacg   g  ccac    cguaa u
       a c     cc         --- gu    guaa     g 
Get sequence
Deep sequencing
785 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 40073284-40073367 [+]
sense
ENSECAT00000011707 ; CLCN5-201; intron 1
Clustered miRNAs
< 10kb from eca-mir-500-1
eca-mir-532chrX: 40068460-40068549 [+]
eca-mir-188chrX: 40068847-40068914 [+]
eca-mir-500-1chrX: 40073284-40073367 [+]
eca-mir-362chrX: 40073827-40073892 [+]
eca-mir-501chrX: 40074566-40074649 [+]
eca-mir-500-2chrX: 40075101-40075184 [+]
eca-mir-660chrX: 40076530-40076626 [+]
eca-mir-502chrX: 40077407-40077486 [+]
Database links

Mature sequence eca-miR-500

Accession MIMAT0013223
Sequence

13 - 

uaauccuugcuaccugggugaga

 - 35

Get sequence
Deep sequencing170 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).