Stem-loop sequence eca-mir-450c

AccessionMI0012967 (change log)
Previous IDseca-mir-451a
DescriptionEquus caballus miR-450c stem-loop
Gene family MIPF0000128; mir-450
Literature search

1 open access papers mention eca-mir-450c
(1 sentences)

Stem-loop
   gaaa     uc      uuu     u               aa 
5'     gaugc  aacuau   ugcga guguuccuaauacgu  u
       |||||  ||||||   ||||| |||||||||||||||  a
3'     cuaug  uugaua   acguu uacaaggguuaugua  u
   auaa     uu      cuu     u               aa 
Get sequence
Deep sequencing
2160 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106948953-106949041 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-450c
eca-mir-424chrX: 106954949-106955046 [-]
eca-mir-503chrX: 106954617-106954687 [-]
eca-mir-542chrX: 106949741-106949826 [-]
eca-mir-450cchrX: 106948953-106949041 [-]
eca-mir-450achrX: 106948818-106948908 [-]
eca-mir-450bchrX: 106948655-106948733 [-]
Database links

Mature sequence eca-miR-450c

Accession MIMAT0013222
Previous IDseca-miR-451a
Sequence

18 - 

uuuugcgauguguuccuaauac

 - 39

Get sequence
Deep sequencing2154 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).