Stem-loop sequence eca-mir-450b

AccessionMI0012966 (change log)
DescriptionEquus caballus miR-450b stem-loop
Gene family MIPF0000128; mir-450
Literature search

1 open access papers mention eca-mir-450b
(2 sentences)

Stem-loop
   -           uuu     u        g    ug aa 
5'  uacaaaauuau   ugcaa auguuccu aaua  u  u
    |||||||||||   ||||| |||||||| ||||  |  a
3'  auguuuugaua   acguu uacaaggg uuau  g  u
   u           ccu     u        -    gu aa 
Get sequence
Deep sequencing
4140 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106948655-106948733 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-450b
eca-mir-424chrX: 106954949-106955046 [-]
eca-mir-503chrX: 106954617-106954687 [-]
eca-mir-542chrX: 106949741-106949826 [-]
eca-mir-450cchrX: 106948953-106949041 [-]
eca-mir-450achrX: 106948818-106948908 [-]
eca-mir-450bchrX: 106948655-106948733 [-]
Database links

Mature sequence eca-miR-450b-5p

Accession MIMAT0013220
Sequence

12 - 

uuuugcaauauguuccugaaua

 - 33

Get sequence
Deep sequencing4134 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-450b-3p

Accession MIMAT0013221
Sequence

49 - 

uugggaacauuuugcauccaua

 - 70

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).