Stem-loop sequence eca-mir-450a

AccessionMI0012965 (change log)
DescriptionEquus caballus miR-450a stem-loop
Gene family MIPF0000128; mir-450
Literature search

2 open access papers mention eca-mir-450a
(2 sentences)

Stem-loop
   --gaaa     u       uuu     u              cag 
5'       gaugc aaacugu   ugcga guguuccuaauaug   u
         ||||| |||||||   ||||| ||||||||||||||   a
3'       cuaug uuuggua   acguu uacgaggguuauau   u
   auauaa     u       cgu     u              aaa 
Get sequence
Deep sequencing
2146 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106948818-106948908 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-450a
eca-mir-424chrX: 106954949-106955046 [-]
eca-mir-503chrX: 106954617-106954687 [-]
eca-mir-542chrX: 106949741-106949826 [-]
eca-mir-450cchrX: 106948953-106949041 [-]
eca-mir-450achrX: 106948818-106948908 [-]
eca-mir-450bchrX: 106948655-106948733 [-]
Database links

Mature sequence eca-miR-450a

Accession MIMAT0013219
Sequence

18 - 

uuuugcgauguguuccuaauau

 - 39

Get sequence
Deep sequencing2140 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).