Stem-loop sequence eca-mir-361

AccessionMI0012956 (change log)
DescriptionEquus caballus miR-361 stem-loop
Gene family MIPF0000172; mir-361
Literature search

2 open access papers mention eca-mir-361
(4 sentences)

Stem-loop
        uu         --u  a    u   gauaa 
5' ggagc  aucagaauc   cc gggg acu     u
   |||||  |||||||||   || |||| |||     u
3' cuucg  uagucuuag   gg cccc uga     u
        uu         ugc  a    c   aaaau 
Get sequence
Deep sequencing
1131 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 65084146-65084216 [-]
sense
ENSECAT00000020467 ; CHM-201; intron 9
Database links

Mature sequence eca-miR-361-5p

Accession MIMAT0013208
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Deep sequencing828 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-361-3p

Accession MIMAT0013209
Sequence

44 - 

ucccccaggcgugauucugauuu

 - 66

Get sequence
Deep sequencing303 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).