Stem-loop sequence eca-mir-224

AccessionMI0012954 (change log)
DescriptionEquus caballus miR-224 stem-loop
Gene family MIPF0000088; mir-224
Literature search

1 open access papers mention eca-mir-224
(4 sentences)

Stem-loop
          ca         u   u      a u   ug  u 
5' gggcuuu  agucacuag ggu ccguuu g aga  gu g
   |||||||  ||||||||| ||| |||||| | |||  || u
3' cccgaaa  ucagugauc ccg gguaaa c uuu  ua g
          ca         -   u      a -   gu  c 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 120688687-120688767 [-]
sense
ENSECAT00000009848 ; GABRE-202; intron 5
ENSECAT00000009828 ; GABRE-201; intron 6
Database links

Mature sequence eca-miR-224

Accession MIMAT0013206
Sequence

8 - 

caagucacuagugguuccguu

 - 28

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).