Stem-loop sequence eca-mir-223

AccessionMI0012953 (change log)
DescriptionEquus caballus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Literature search

4 open access papers mention eca-mir-223
(8 sentences)

Stem-loop
   gcccagccuccu   -     a    cc u              gaguug       cau 
5'             gca gugcc cgcu  g guauuugacaagcu      gacacuc   g
               ||| ||||| ||||  | ||||||||||||||      |||||||   u
3'             cgu cacgg guga  c cauaaacuguuuga      cugugag   g
   ------------   a     c    ac c              ------       aug 
Get sequence
Deep sequencing
117 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 48492588-48492691 [+]
intergenic
Database links

Mature sequence eca-miR-223

Accession MIMAT0013205
Sequence

69 - 

ugucaguuugucaaauacccca

 - 90

Get sequence
Deep sequencing102 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).