Stem-loop sequence eca-mir-221

AccessionMI0012951 (change log)
DescriptionEquus caballus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

4 open access papers mention eca-mir-221
(8 sentences)

Stem-loop
   -----ccaaca       cugg   a    -  ug   u         auuu    -   u 
5'            uccaggu    ggc ugaa cc  gca acaauguag    cugu guu c
              |||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
3'            aggucca    ucg acuu gg  cgu uguuacauc    gaca cgg u
   cucuuguacaa       ----   g    u  gu   c         ----    a   g 
Get sequence
Deep sequencing
897 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 37090647-37090756 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-221
eca-mir-222chrX: 37091426-37091535 [-]
eca-mir-221chrX: 37090647-37090756 [-]
Database links

Mature sequence eca-miR-221

Accession MIMAT0013203
Sequence

65 - 

agcuacauugucugcuggguuuc

 - 87

Get sequence
Deep sequencing846 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).