Stem-loop sequence eca-mir-20b

AccessionMI0012950 (change log)
DescriptionEquus caballus miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention eca-mir-20b
(2 sentences)

Stem-loop
        -ca           g     g   uuuu gc 
5' aguac   aagugcucaua ugcag uag    g  a
   |||||   ||||||||||| ||||| |||    |   
3' ucaug   uucacgggugu auguc auc    c  u
        acc           g     -   ---u au 
Get sequence
Deep sequencing
675 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106692311-106692379 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-20b
eca-mir-106achrX: 106692701-106692781 [-]
eca-mir-18bchrX: 106692551-106692609 [-]
eca-mir-20bchrX: 106692311-106692379 [-]
eca-mir-19b-2chrX: 106692173-106692268 [-]
eca-mir-92a-2chrX: 106692042-106692116 [-]
eca-mir-363chrX: 106691883-106691957 [-]
Database links

Mature sequence eca-miR-20b

Accession MIMAT0013202
Sequence

6 - 

caaagugcucauagugcagguag

 - 28

Get sequence
Deep sequencing659 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).