Stem-loop sequence eca-mir-19b-2

AccessionMI0012949 (change log)
DescriptionEquus caballus miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Literature search

1 open access papers mention eca-mir-19b-2
(2 sentences)

Stem-loop
   acacugcuac                 -  -      uuu    g      u 
5'           uuacgauuaguuuugca gg uuugca   cagc uauaua g
             ||||||||||||||||| || ||||||   |||| ||||||  
3'           aguguuagucaaaacgu cc aaacgu   gucg guauau u
   ----uguaau                 a  u      ---    -      a 
Get sequence
Deep sequencing
1991 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106692173-106692268 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-19b-2
eca-mir-106achrX: 106692701-106692781 [-]
eca-mir-18bchrX: 106692551-106692609 [-]
eca-mir-20bchrX: 106692311-106692379 [-]
eca-mir-19b-2chrX: 106692173-106692268 [-]
eca-mir-92a-2chrX: 106692042-106692116 [-]
eca-mir-363chrX: 106691883-106691957 [-]
Database links

Mature sequence eca-miR-19b

Accession MIMAT0013087
Sequence

62 - 

ugugcaaauccaugcaaaacuga

 - 84

Get sequence
Deep sequencing3930 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).