Stem-loop sequence eca-mir-18b

AccessionMI0012947 (change log)
DescriptionEquus caballus miR-18b stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention eca-mir-18b
(2 sentences)

Stem-loop
   ua   u    c   u     ua  --g     
5'   agg gcau uag gcagu  gu   aagc 
     ||| |||| ||| |||||  ||   ||| a
3'   ucc cgua auc cguca  ua   uucg 
   --   c    a   c     uc  aga     
Get sequence
Deep sequencing
100 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106692551-106692609 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-18b
eca-mir-106achrX: 106692701-106692781 [-]
eca-mir-18bchrX: 106692551-106692609 [-]
eca-mir-20bchrX: 106692311-106692379 [-]
eca-mir-19b-2chrX: 106692173-106692268 [-]
eca-mir-92a-2chrX: 106692042-106692116 [-]
eca-mir-363chrX: 106691883-106691957 [-]
Database links

Mature sequence eca-miR-18b

Accession MIMAT0013200
Sequence

1 - 

uaaggugcaucuagugcaguuag

 - 23

Get sequence
Deep sequencing100 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).