Stem-loop sequence eca-mir-188

AccessionMI0012946 (change log)
DescriptionEquus caballus miR-188 stem-loop
Gene family MIPF0000113; mir-188
Literature search

1 open access papers mention eca-mir-188
(2 sentences)

Stem-loop
      ca  uc         gu      -ugag u 
5' ucu  ca  ccuugcaug  ggaggg     c u
   |||  ||  |||||||||  ||||||     | u
3' agg  gu  gggacguac  ccuccc     g c
      ac  uu         ac      caaaa u 
Get sequence
Deep sequencing
55 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 40068847-40068914 [+]
sense
ENSECAT00000011707 ; CLCN5-201; intron 1
ENSECAT00000027952 ; eca-mir-188-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-188
eca-mir-532chrX: 40068460-40068549 [+]
eca-mir-188chrX: 40068847-40068914 [+]
eca-mir-500-1chrX: 40073284-40073367 [+]
eca-mir-362chrX: 40073827-40073892 [+]
eca-mir-501chrX: 40074566-40074649 [+]
eca-mir-500-2chrX: 40075101-40075184 [+]
eca-mir-660chrX: 40076530-40076626 [+]
eca-mir-502chrX: 40077407-40077486 [+]
Database links

Mature sequence eca-miR-188-5p

Accession MIMAT0013198
Sequence

6 - 

caucccuugcaugguggaggg

 - 26

Get sequence
Deep sequencing38 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-188-3p

Accession MIMAT0013199
Sequence

45 - 

cucccacaugcaggguuugca

 - 65

Get sequence
Deep sequencing16 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).