Stem-loop sequence eca-mir-106a

AccessionMI0012942 (change log)
DescriptionEquus caballus miR-106a stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention eca-mir-106a
(1 sentences)

Stem-loop
     u   cc    -ca        a  g     g   c  u 
5' cc ugg  augu   aagugcuu ca ugcag uag uu c
   || |||  ||||   |||||||| || ||||| ||| || u
3' gg acc  uaca   uucacgaa gu acguc auc ag g
     u   au    uuc        c  a     -   u  a 
Get sequence
Deep sequencing
1450 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106692701-106692781 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-106a
eca-mir-106achrX: 106692701-106692781 [-]
eca-mir-18bchrX: 106692551-106692609 [-]
eca-mir-20bchrX: 106692311-106692379 [-]
eca-mir-19b-2chrX: 106692173-106692268 [-]
eca-mir-92a-2chrX: 106692042-106692116 [-]
eca-mir-363chrX: 106691883-106691957 [-]
Database links

Mature sequence eca-miR-106a

Accession MIMAT0013194
Sequence

13 - 

caaagugcuuacagugcagguag

 - 35

Get sequence
Deep sequencing1440 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).