Stem-loop sequence eca-mir-215

AccessionMI0012938 (change log)
DescriptionEquus caballus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Literature search

1 open access papers mention eca-mir-215
(4 sentences)

Stem-loop
   aucauua  aaau           a a  a     -   u          uaug 
5'        ag    gguauacagga a ug ccuau gaa ugacagacaa    a
          ||    ||||||||||| | || ||||| ||| ||||||||||    c
3'        uc    cuauaugucuu u ac ggaug cuu acugucuguu    u
   aacuuca  gucu           a a  c     u   u          ugaa 
Get sequence
Deep sequencing
667 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr30: 10337621-10337730 [-]
antisense
ENSECAT00000024407 ; IARS2-201; intron 12
Clustered miRNAs
< 10kb from eca-mir-215
eca-mir-194-2chr30: 10337925-10338009 [-]
eca-mir-215chr30: 10337621-10337730 [-]
Database links

Mature sequence eca-miR-215

Accession MIMAT0013190
Sequence

27 - 

augaccuaugaauugacagac

 - 47

Get sequence
Deep sequencing667 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).