Stem-loop sequence eca-mir-194-2

AccessionMI0012937 (change log)
DescriptionEquus caballus miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Literature search

1 open access papers mention eca-mir-194-2
(1 sentences)

Stem-loop
   a   - gu       u         a      g    --c     
5'  ugg g  caucaag guaacagca cuccau ugga   uggg 
    ||| |  ||||||| ||||||||| |||||| ||||   ||| u
3'  acc u  guaguuu cauugucgu gaggug accu   acca 
   a   a ug       u         a      -    uua     
Get sequence
Deep sequencing
25 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr30: 10337925-10338009 [-]
antisense
ENSECAT00000024407 ; IARS2-201; intron 12
Clustered miRNAs
< 10kb from eca-mir-194-2
eca-mir-194-2chr30: 10337925-10338009 [-]
eca-mir-215chr30: 10337621-10337730 [-]
Database links

Mature sequence eca-miR-194

Accession MIMAT0013050
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing50 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).