Stem-loop sequence eca-mir-181a-2

AccessionMI0012936 (change log)
DescriptionEquus caballus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention eca-mir-181a-2
(6 sentences)

Stem-loop
   -u   ucu      u   ----u   u a   u      cu       a    g  au 
5'   gag   gagggu gcu     cag g aca ucaacg  gucggug guuu ga  u
     |||   |||||| |||     ||| | ||| ||||||  ||||||| |||| ||  a
3'   cuc   cuccua cga     guc c ugu aguugc  cagcuac caaa cu  a
   ac   -cu      c   ucggu   c g   u      --       -    a  aa 
Get sequence
Deep sequencing
149294 reads, 1.06e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr30: 26398918-26399027 [-]
intergenic
Database links

Mature sequence eca-miR-181a

Accession MIMAT0013178
Sequence

24 - 

aacauucaacgcugucggugagu

 - 46

Get sequence
Deep sequencing296183 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).