Stem-loop sequence eca-mir-331

AccessionMI0012934 (change log)
DescriptionEquus caballus miR-331 stem-loop
Gene family MIPF0000199; mir-331
Literature search

1 open access papers mention eca-mir-331
(2 sentences)

Stem-loop
   gaauuugguuuu         u        u    u       au ccaga 
5'             guuuggguu guucuagg augg cccaggg  c     u
               ||||||||| |||||||| |||| |||||||  |     c
3'             caaauccaa caagaucc uauc ggguccc  g     a
   ------------         c        -    c       cg accaa 
Get sequence
Deep sequencing
125 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr28: 20407820-20407911 [+]
intergenic
Database links

Mature sequence eca-miR-331

Accession MIMAT0013188
Sequence

61 - 

gccccugggccuauccuagaa

 - 81

Get sequence
Deep sequencing75 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).