Stem-loop sequence eca-let-7a-2

AccessionMI0012932 (change log)
DescriptionEquus caballus let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

5 open access papers mention eca-let-7a-2
(8 sentences)

Stem-loop
      u   gu               uuggggcuc      g 
5' ggg gag  aguagguuguauagu         ugcccu c
   ||| |||  |||||||||||||||         |||||| u
3' ucc uuc  ucaucuaacauauca         augggg a
      u   ug               ---------      u 
Get sequence
Deep sequencing
222266 reads, 1.62e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr28: 42016388-42016461 [+]
intergenic
Database links

Mature sequence eca-let-7a

Accession MIMAT0012979
Sequence

4 - 

ugagguaguagguuguauaguu

 - 25

Get sequence
Deep sequencing444307 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).