Stem-loop sequence eca-mir-486

AccessionMI0012931 (change log)
DescriptionEquus caballus miR-486 stem-loop
Gene family MIPF0000220; mir-486
Literature search

6 open access papers mention eca-mir-486
(19 sentences)

Stem-loop
   gg                      ----   c uu 
5'   auccuguacugagcugccccga    ggc c  c
     ||||||||||||||||||||||    ||| |   
3'   uaggacaugacucgacggggcu    ccg g  a
   --                      cgac   u uc 
Get sequence
Deep sequencing
94188 reads, 6.7e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr27: 3709569-3709634 [+]
sense
ENSECAT00000016145 ; ANK1-201; intron 40
Database links

Mature sequence eca-miR-486-5p

Accession MIMAT0013186
Sequence

4 - 

uccuguacugagcugccccgag

 - 25

Get sequence
Deep sequencing94177 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-486-3p

Accession MIMAT0013187
Sequence

46 - 

cggggcagcucaguacaggau

 - 66

Get sequence
Deep sequencing11 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).