Stem-loop sequence eca-mir-383

AccessionMI0012930 (change log)
DescriptionEquus caballus miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
      -c  a      aa    a        uug   gga 
5' cuc  uc gaucag  ggug uuguggcu   ggu   u
   |||  || ||||||  |||| ||||||||   |||    
3' gag  ag cugguc  ucac gacaccga   cua   a
      aa  a      cg    -        ---   auu 
Get sequence
Deep sequencing
355 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr27: 18266585-18266657 [-]
intergenic
Database links

Mature sequence eca-miR-383

Accession MIMAT0013185
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Deep sequencing349 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).