Stem-loop sequence eca-mir-155

AccessionMI0012927 (change log)
DescriptionEquus caballus miR-155 stem-loop
Gene family MIPF0000157; mir-155
Literature search

7 open access papers mention eca-mir-155
(71 sentences)

Stem-loop
                u    a        uuua c 
5' cuguuaaugcuaa cgug uagggguu    c u
   ||||||||||||| |||| ||||||||    |  
3' gacaauuacgauu guac auccucag    g c
                -    -        -uca g 
Get sequence
Deep sequencing
3360 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr26: 23253374-23253438 [+]
intergenic
Database links

Mature sequence eca-miR-155

Accession MIMAT0013182
Sequence

4 - 

uuaaugcuaaucgugauaggggu

 - 26

Get sequence
Deep sequencing3355 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).