Stem-loop sequence eca-mir-199b

AccessionMI0012922 (change log)
DescriptionEquus caballus miR-199b stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
        c       u       u    u  ----  a 
5' gucua ccagugu uagacua cugu ca    gg c
   ||||| ||||||| ||||||| |||| ||    ||  
3' cggau gguuaca gucugau gaca gu    cc u
        u       c       -    u  uaaa  c 
Get sequence
Deep sequencing
62162 reads, 4.2e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr25: 31553692-31553760 [-]
sense
ENSECAT00000028366 ; eca-mir-199b-201; exon 1
antisense
ENSECAT00000025252 ; DNM1-201; intron 16
ENSECAT00000025260 ; DNM1-202; intron 16
Database links

Mature sequence eca-miR-199b-5p

Accession MIMAT0013780
Sequence

6 - 

cccaguguuuagacuaucuguuc

 - 28

Get sequence
Deep sequencing3108 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-199b-3p

Accession MIMAT0013781
Sequence

45 - 

acaguagucugcacauugguua

 - 66

Get sequence
Deep sequencing59054 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).