Stem-loop sequence eca-mir-181b

AccessionMI0012921 (change log)
DescriptionEquus caballus miR-181b stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention eca-mir-181b
(8 sentences)

Stem-loop
   cuga   -     cucaa         cu           u  gu 
5'     ugg cugca     cauucauug  gucgguggguu ga  c
       ||| |||||     |||||||||  ||||||||||| ||  u
3'     acc ggcgu     guaaguaac  uagucacucaa cu  g
   acaa   a     caaac         --           -  aa 
Get sequence
Deep sequencing
6838 reads, 400 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr25: 28673901-28673989 [+]
antisense
ENSECAT00000022828 ; NR6A1-201; intron 2
Clustered miRNAs
< 10kb from eca-mir-181b
eca-mir-181achr25: 28672622-28672731 [+]
eca-mir-181bchr25: 28673901-28673989 [+]
Database links

Mature sequence eca-miR-181b

Accession MIMAT0013179
Sequence

16 - 

aacauucauugcugucggugggu

 - 38

Get sequence
Deep sequencing6836 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).