Stem-loop sequence eca-mir-181a

AccessionMI0012920 (change log)
DescriptionEquus caballus miR-181a stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention eca-mir-181a
(10 sentences)

Stem-loop
   aagggcugccaggacccagccuuca             a   u      cu       a    ggga 
5'                          gaggacuccaagg aca ucaacg  gucggug guuu    u
                            ||||||||||||| ||| ||||||  ||||||| ||||    u
3'                          uuccugggguucc ugu aguugc  cagccac caaa    u
   ------------------------a             a   c      --       -    aaag 
Get sequence
Deep sequencing
149543 reads, 1.06e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr25: 28672622-28672731 [+]
antisense
ENSECAT00000022828 ; NR6A1-201; intron 2
Clustered miRNAs
< 10kb from eca-mir-181a
eca-mir-181achr25: 28672622-28672731 [+]
eca-mir-181bchr25: 28673901-28673989 [+]
Database links

Mature sequence eca-miR-181a

Accession MIMAT0013178
Sequence

39 - 

aacauucaacgcugucggugagu

 - 61

Get sequence
Deep sequencing296183 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).