Stem-loop sequence eca-mir-126

AccessionMI0012919 (change log)
DescriptionEquus caballus miR-126 stem-loop
Gene family MIPF0000115; mir-126
Literature search

1 open access papers mention eca-mir-126
(4 sentences)

Stem-loop
         - a           u       c cug   c 
5' cgacgg g cauuauuacuu ugguacg g   uga a
   |||||| | ||||||||||| ||||||| |   |||  
3' gcugcc c guaauaaugag gccaugc c   acu c
         g -           u       u -aa   u 
Get sequence
Deep sequencing
17433 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr25: 37315402-37315474 [-]
sense
ENSECAT00000016463 ; EGFL7-201; intron 7
Database links

Mature sequence eca-miR-126-5p

Accession MIMAT0013176
Sequence

9 - 

cauuauuacuuuugguacgcg

 - 29

Get sequence
Deep sequencing15079 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-126-3p

Accession MIMAT0013177
Sequence

46 - 

ucguaccgugaguaauaaugcg

 - 67

Get sequence
Deep sequencing2354 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).