Stem-loop sequence eca-mir-758

AccessionMI0012916 (change log)
DescriptionEquus caballus miR-758 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   gcc       a    --a    u      aga   c   - uuu 
5'    uggguac ugag   uggu gaccag   gca acg c   a
      ||||||| ||||   |||| ||||||   ||| ||| |   u
3'    aucuaug acuc   auca cugguc   ugu ugc g   u
   --a       -    cca    c      cag   u   c ugu 
Get sequence
Deep sequencing
398 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42898599-42898683 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-758
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
Database links

Mature sequence eca-miR-758

Accession MIMAT0013173
Sequence

52 - 

uuugugaccugguccacuaacc

 - 73

Get sequence
Deep sequencing385 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).