Stem-loop sequence eca-mir-656

AccessionMI0012915 (change log)
DescriptionEquus caballus miR-656 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention eca-mir-656
(1 sentences)

Stem-loop
   ---------- u    u      c     ag       cuu  u 
5'           c gaaa agguug cugug  guguuca   uc a
             | |||| |||||| |||||  |||||||   || u
3'           g cuuu uccaac gacau  uauaagu   ag a
   cuaagcuaag c    c      u     au       ---  c 
Get sequence
Deep sequencing
214 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42937011-42937088 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-656
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
eca-mir-409chr24: 42935634-42935712 [+]
eca-mir-412chr24: 42935784-42935863 [+]
eca-mir-369chr24: 42935933-42936002 [+]
eca-mir-410chr24: 42936264-42936337 [+]
eca-mir-656chr24: 42937011-42937088 [+]
Database links

Mature sequence eca-miR-656

Accession MIMAT0013172
Sequence

43 - 

aauauuauacagucaaccucu

 - 63

Get sequence
Deep sequencing213 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).