Stem-loop sequence eca-mir-543

AccessionMI0012912 (change log)
DescriptionEquus caballus miR-543 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
     u          u  -     ---u    u    uu 
5' cu aaggagaagu gc ccgug    uuuu ucgc  u
   || |||||||||| || |||||    |||| ||||  a
3' ga uuuuucuuca cg ggcgc    aaag agug  u
     c          -  u     uuac    c    uu 
Get sequence
Deep sequencing
67 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42904247-42904318 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-543
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
eca-mir-376cchr24: 42911104-42911169 [+]
eca-mir-376bchr24: 42911856-42911937 [+]
eca-mir-376achr24: 42912234-42912301 [+]
Database links

Mature sequence eca-miR-543

Accession MIMAT0013169
Sequence

45 - 

aaacauucgcggugcacuucuu

 - 66

Get sequence
Deep sequencing67 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).