Stem-loop sequence eca-mir-541

AccessionMI0012911 (change log)
DescriptionEquus caballus miR-541 stem-loop
Gene family MIPF0000213; mir-541
Stem-loop
   -   -u      aa        c    g uc    u   gaguu 
5'  acg  caggga  ggauucug uguc g  ccac cca     c
    |||  ||||||  |||||||| |||| |  |||| |||      
3'  ugu  gucucu  ccuaagac acgg u  ggug ggu     g
   g   uc      ga        -    g --    -   aaaac 
Get sequence
Deep sequencing
63 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42934714-42934797 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-541
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
eca-mir-409chr24: 42935634-42935712 [+]
eca-mir-412chr24: 42935784-42935863 [+]
eca-mir-369chr24: 42935933-42936002 [+]
eca-mir-410chr24: 42936264-42936337 [+]
eca-mir-656chr24: 42937011-42937088 [+]
Database links

Mature sequence eca-miR-541

Accession MIMAT0013168
Sequence

54 - 

uggugggcacagaauccagucu

 - 75

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).