Stem-loop sequence eca-mir-495

AccessionMI0012908 (change log)
DescriptionEquus caballus miR-495 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   u   c  u          u  -       au     - uug 
5'  ggu cc gaaaagaagu gc ccauguu  uuucg c   a
    ||| || |||||||||| || |||||||  ||||| |   u
3'  cua gg uuuuucuuca cg gguacaa  aaagc g   a
   a   u  c          -  u       ac     a ugu 
Get sequence
Deep sequencing
132 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42906084-42906165 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-495
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
eca-mir-376cchr24: 42911104-42911169 [+]
eca-mir-376bchr24: 42911856-42911937 [+]
eca-mir-376achr24: 42912234-42912301 [+]
eca-mir-1185chr24: 42914351-42914436 [+]
eca-mir-381chr24: 42916054-42916128 [+]
Database links

Mature sequence eca-miR-495

Accession MIMAT0013165
Sequence

50 - 

aaacaaacauggugcacuucuu

 - 71

Get sequence
Deep sequencing131 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).