Stem-loop sequence eca-mir-494

AccessionMI0012907 (change log)
DescriptionEquus caballus miR-494 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention eca-mir-494
(1 sentences)

Stem-loop
         c            gu      -   c   -  uuu 
5' gauacu gaaggagagguu  ccgugu ugu uuc uc   a
   |||||| ||||||||||||  |||||| ||| ||| ||   u
3' cuauga uuuuuucuccaa  ggcaca aca aag ag   u
         -            ag      u   -   u  uau 
Get sequence
Deep sequencing
94 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42902171-42902251 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-494
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
eca-mir-376cchr24: 42911104-42911169 [+]
eca-mir-376bchr24: 42911856-42911937 [+]
Database links

Mature sequence eca-miR-494

Accession MIMAT0013164
Sequence

48 - 

ugaaacauacacgggaaaccuc

 - 69

Get sequence
Deep sequencing93 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).