Stem-loop sequence eca-mir-487a

AccessionMI0012904 (change log)
DescriptionEquus caballus miR-487a stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         u     g   uua      c    -    cu  a 
5' gguacu gaaga ugg   ucccug ugug uucg  gu u
   |||||| ||||| |||   |||||| |||| ||||  ||  
3' cuauga uuuuu acc   agggac auac aagc  ua u
         c     g   uac      -    u    ag  u 
Get sequence
Deep sequencing
284 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42921992-42922071 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-487a
eca-mir-376achr24: 42912234-42912301 [+]
eca-mir-1185chr24: 42914351-42914436 [+]
eca-mir-381chr24: 42916054-42916128 [+]
eca-mir-487bchr24: 42916520-42916603 [+]
eca-mir-539chr24: 42917365-42917442 [+]
eca-mir-889chr24: 42917940-42918017 [+]
eca-mir-544-2chr24: 42918692-42918781 [+]
eca-mir-655chr24: 42919594-42919690 [+]
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
Database links

Mature sequence eca-miR-487a

Accession MIMAT0013161
Sequence

49 - 

aaucauacagggacauccaguu

 - 70

Get sequence
Deep sequencing261 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).