Stem-loop sequence eca-mir-485

AccessionMI0012903 (change log)
DescriptionEquus caballus miR-485 stem-loop
Gene family MIPF0000201; mir-485
Stem-loop
      u         cu       -    a    auuc 
5' acu gaagagagg  ggccgug auga uucg    a
   ||| |||||||||  ||||||| |||| ||||    u
3' uga uuucucucc  ucggcac uacu gagc    c
      u         uc       a    -    gaaa 
Get sequence
Deep sequencing
265 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42925986-42926058 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-485
eca-mir-381chr24: 42916054-42916128 [+]
eca-mir-487bchr24: 42916520-42916603 [+]
eca-mir-539chr24: 42917365-42917442 [+]
eca-mir-889chr24: 42917940-42918017 [+]
eca-mir-544-2chr24: 42918692-42918781 [+]
eca-mir-655chr24: 42919594-42919690 [+]
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
eca-mir-409chr24: 42935634-42935712 [+]
eca-mir-412chr24: 42935784-42935863 [+]
eca-mir-369chr24: 42935933-42936002 [+]
Database links

Mature sequence eca-miR-485-5p

Accession MIMAT0013159
Sequence

9 - 

agaggcuggccgugaugaauuc

 - 30

Get sequence
Deep sequencing135 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-485-3p

Accession MIMAT0013160
Sequence

46 - 

gucauacacggcucuccucucu

 - 67

Get sequence
Deep sequencing129 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).