Stem-loop sequence eca-mir-412

AccessionMI0012899 (change log)
DescriptionEquus caballus miR-412 stem-loop
Gene family MIPF0000192; mir-412
Stem-loop
         a   g  a    c      u   aa    -    u 
5' ggguac gga gg uggu gaccag ugg  agua auug u
   |||||| ||| || |||| |||||| |||  |||| ||||  
3' cccaug ccu cc auca cugguc acu  ucau uaau u
         -   g  g    c      c   --    g    c 
Get sequence
Deep sequencing
413 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42935784-42935863 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-412
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
eca-mir-409chr24: 42935634-42935712 [+]
eca-mir-412chr24: 42935784-42935863 [+]
eca-mir-369chr24: 42935933-42936002 [+]
eca-mir-410chr24: 42936264-42936337 [+]
eca-mir-656chr24: 42937011-42937088 [+]
Database links

Mature sequence eca-miR-412

Accession MIMAT0013155
Sequence

52 - 

uucaccugguccacuagccg

 - 71

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).