Stem-loop sequence eca-mir-411

AccessionMI0012898 (change log)
DescriptionEquus caballus miR-411 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   u      ug   a a    a      a a       - uuu 
5'  gguacu  gag g uagu gaccgu u gcguacg c   a
    ||||||  ||| | |||| |||||| | ||||||| |   u
3'  cuauga  cuc c auca cuggca a uguaugc g   c
   a      --   c a    c      c a       a ugu 
Get sequence
Deep sequencing
39462 reads, 2.75e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42895895-42895976 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-411
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
Database links

Mature sequence eca-miR-411

Accession MIMAT0013154
Sequence

16 - 

uaguagaccguauagcguacg

 - 36

Get sequence
Deep sequencing39128 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).