Stem-loop sequence eca-mir-410

AccessionMI0012897 (change log)
DescriptionEquus caballus miR-410 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention eca-mir-410
(2 sentences)

Stem-loop
   ------      g    ug      a  a     - uuu 
5'       ugagga aggu  ucugug ug guucg c   a
         |||||| ||||  |||||| || ||||| |   u
3'       acuucu uccg  agacac au uaagc g   u
   accaug      g    gu      a  a     a uaa 
Get sequence
Deep sequencing
3183 reads, 200 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42936264-42936337 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-410
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
eca-mir-409chr24: 42935634-42935712 [+]
eca-mir-412chr24: 42935784-42935863 [+]
eca-mir-369chr24: 42935933-42936002 [+]
eca-mir-410chr24: 42936264-42936337 [+]
eca-mir-656chr24: 42937011-42937088 [+]
Database links

Mature sequence eca-miR-410

Accession MIMAT0013153
Sequence

43 - 

aauauaacacagauggccugu

 - 63

Get sequence
Deep sequencing3182 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).