Stem-loop sequence eca-mir-382

AccessionMI0012895 (change log)
DescriptionEquus caballus miR-382 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
       u       -a           ug      - uuu 
5' uacu gaagaga  guuguucgugg  gauucg c   a
   |||| |||||||  |||||||||||  |||||| |   c
3' auga cuuuuuu  caacaggcacu  cuaagc g   u
       -       ca           ua      a uau 
Get sequence
Deep sequencing
132 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42924862-42924937 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-382
eca-mir-381chr24: 42916054-42916128 [+]
eca-mir-487bchr24: 42916520-42916603 [+]
eca-mir-539chr24: 42917365-42917442 [+]
eca-mir-889chr24: 42917940-42918017 [+]
eca-mir-544-2chr24: 42918692-42918781 [+]
eca-mir-655chr24: 42919594-42919690 [+]
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
Database links

Mature sequence eca-miR-382

Accession MIMAT0013150
Sequence

11 - 

gaaguuguucgugguggauucg

 - 32

Get sequence
Deep sequencing92 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).