Stem-loop sequence eca-mir-380

AccessionMI0012893 (change log)
DescriptionEquus caballus miR-380 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
         guu       ga       -  gu 
5' aagacg   gaccaua  gcaugcg cu  c
   ||||||   |||||||  ||||||| ||  u
3' uucugc   cugguau  uguaugc gg  c
         -ac       aa       u  au 
Get sequence
Deep sequencing
537 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42897592-42897652 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-380
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
Database links

Mature sequence eca-miR-380

Accession MIMAT0013148
Sequence

40 - 

uauguaauaugguccacgucuu

 - 61

Get sequence
Deep sequencing532 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).