Stem-loop sequence eca-mir-379

AccessionMI0012892 (change log)
DescriptionEquus caballus miR-379 stem-loop
Gene family MIPF0000126; mir-379
Literature search

1 open access papers mention eca-mir-379
(1 sentences)

Stem-loop
       a    a       ga       - uuuau 
5' agag uggu gacuaug  acguagg c     g
   |||| |||| |||||||  ||||||| |      
3' ucuc auca cugguac  uguaucc g     a
       a    c       aa       a uuuuu 
Get sequence
Deep sequencing
1604 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42894643-42894709 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-379
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
Database links

Mature sequence eca-miR-379

Accession MIMAT0013147
Sequence

6 - 

ugguagacuauggaacguagg

 - 26

Get sequence
Deep sequencing1264 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).