Stem-loop sequence eca-mir-377

AccessionMI0012891 (change log)
DescriptionEquus caballus miR-377 stem-loop
Gene family MIPF0000018; mir-154
Literature search

2 open access papers mention eca-mir-377
(2 sentences)

Stem-loop
   uu              c   -    a    - uuu 
5'   gagcagagguugcc uug guga uucg c   a
     |||||||||||||| ||| |||| |||| |   u
3'   uuuguuuucaacgg aac cacu aagu g   u
   -g              a   a    -    u uau 
Get sequence
Deep sequencing
146 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42932739-42932807 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-377
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
eca-mir-409chr24: 42935634-42935712 [+]
eca-mir-412chr24: 42935784-42935863 [+]
eca-mir-369chr24: 42935933-42936002 [+]
eca-mir-410chr24: 42936264-42936337 [+]
eca-mir-656chr24: 42937011-42937088 [+]
Database links

Mature sequence eca-miR-377

Accession MIMAT0013146
Sequence

45 - 

aucacacaaaggcaacuuuugu

 - 66

Get sequence
Deep sequencing85 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).